Home| Letters| Links| RSS| About Us| Contact Us

On the Frontline

What's New

Table of Contents

Index of Authors

Index of Titles

Index of Letters

Mailing List


subscribe to our mailing list:



SECTIONS

Critique of Intelligent Design

Evolution vs. Creationism

The Art of ID Stuntmen

Faith vs Reason

Anthropic Principle

Autopsy of the Bible code

Science and Religion

Historical Notes

Counter-Apologetics

Serious Notions with a Smile

Miscellaneous

Letter Serial Correlation

Mark Perakh's Web Site

29+ Evidences for Macroevolution

Part 4:
Molecular Sequence Evidence

Copyright 1999-2003 by Douglas Theobald, Ph.D.

Cytochrome c gene coding sequence for Pan troglodytes
Cytochrome c gene coding sequence for Homo sapiens

CLUSTAL W (1.83) multiple sequence alignment


human_cytc      ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
chimp_cytc      ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
                ******************************************************** ***

human_cytc      GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
chimp_cytc      GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
                ************************************************** *********

human_cytc      ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
chimp_cytc      ACAGGTCAGGCCCCTGGATATTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
                ******************** ***************************************

human_cytc      GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
chimp_cytc      GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
                ************************************************************

human_cytc      ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
chimp_cytc      ATGATATTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
                ***** ******************************************************

human_cytc      AAAGCTACTAATGAGTAA
chimp_cytc      AAAGCTACTAATGAGTAA
                ******************